You are here

Article Text

Article menu

Download PDFPDF

Workplace
Original article
High lead exposure is associated with telomere length shortening in Chinese battery manufacturing plant workers
  1. Yixing Wu1,2,
  2. Yimin Liu2,
  3. Na Ni3,
  4. Bei Bao2,
  5. Cheng Zhang2,
  6. Lingeng Lu3
  1. 1Department of Internal Medicine, The Fourth Hospital Affiliated to Guangzhou Medical College, Guangzhou, China
  2. 2Department of Occupational Disease, Guangzhou No.12 Hospital Affiliated to Guangzhou Medical College, Guangzhou, China
  3. 3Department of Epidemiology and Public Health, Yale University School of Medicine, New Haven, Connecticut, USA
  1. Correspondence to Dr Yixing Wu, Department of Occupational Disease, Guangzhou No.12 Affiliated Hospital, Guangzhou Medical College, Guangzhou, Guangdong 510620, China; wyxingz{at}hotmail.com

Abstract

Objectives Critically shortening of telomere length caused by various factors including environmental pollutants results in genome instability and age-associated diseases. Lead is one of the ubiquitous environmental and occupational pollutants, potentially affecting public health even at a low level. However, it is still unclear whether lead exposure affects telomere length. This study aims to investigate the association between lead exposure and peripheral white blood cell telomere length (PWBTL) in Chinese battery manufacturing plant workers.

Methods Lead levels in blood (BLL) and urine (ULL) were evaluated using flame atomic absorption spectrometry and lead mobilisation test for body lead burden (BLB) assessment, respectively. Quantitative PCR was employed to determine relative PWBTL. Univariate and multivariate analyses were performed to examine the associations of telomere length and other variables.

Results PWBTL averaged 1.76 (telomere/single-copy gene of albumin, T/S) in 144 battery plant workers. Significantly shorter PWBTL was observed in the workers with abnormal BLL and/or ULL than those with normal ones (1.66±0.63 vs 1.91±0.46, p=0.010). In all workers, PWBTL was in negative correlations with BLL, ULL, time working at the plant (working length) and body mass index. A strong inverse correlation was observed between PWBTL and BLB (r=−0.70, p<0.0001) in those with abnormal BLL and ULL. GLMSELECT model showed in the subgroup of inpatient workers, working length and BLB were significantly in inverse associations with PWBTL, while BLL was in weak positive association with PWBTL.

Conclusions These findings suggest that PWBTL shortening is associated with long-term lead exposure and that PWBTL may be one of the targets damaged by lead toxicity.

  • Telomere length
  • lead exposure
  • battery workers
  • blood lead levels (BLL)
  • body lead burden (BLB)
  • epidemiology
  • cancer
  • pollution
  • genotoxicity
  • cross-sectional studies

https://doi.org/10.1136/oemed-2011-100478

Statistics from Altmetric.com

    Request Permissions

    If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

    What is known about this subject

    • Better understanding of the underlying molecular mechanisms of lead-caused genotoxicity.

    What this paper adds

    • Lead exposure, particularly long-term exposure, significantly results in telomere length shortening in Chinese battery plant workers.

    Policy implications

    • Telomeres may be a potential target in the prevention and control of lead genotoxicity.

    Introduction

    Telomeres are complicated structures composed of repetitive G-rich sequences (TTAGGG)n and located at the terminal ends of chromosomes.1 Together with associated proteins to form a complex, telomeres play important roles in maintenance of genomic integrity and cell proliferation. Telomere length shortening occurs with each cell division during mitosis and meiosis, and if the telomere cannot be efficiently elongated through a certain mechanism, eventually the cell will enter senescence or apoptosis when telomere length reaches a critical size. A critically shortened telomere can result in genomic instability, causing chromosomal rearrangement and fold-back inversion and further leading to dysregulated cell cycle control, which is a hallmark of ageing-related diseases.2 Epidemiological investigations have shown that individuals with shorter telomeres in circulating leucocytes have decreased life expectancy and higher mortality,3–5 increased risk of cancer6 and cardiovascular diseases7–9 including severe coronary heart disease, stroke, atherosclerosis, heart failure and hypertension.

    Telomere length has been shown to be affected by various environmental factors including oxidative stress, psychological stresses, hormones and growth factors.2 ,10–12 Heavy metal ion exposure, for example, Zn2+ and Sn2+, can induce ageing and telomere length shortening.13 Studies have shown that short-term exposure to heavy metals caused both acute chromosome damage and genomic instability in the progeny of exposed cells.14 ,15

    Lead (Pb) compounds are widely used in industrial processes, and their soluble Pb ions are among the oldest pollutants ubiquitously in the environments. In some major lead-use industries, such as battery manufacture, vanadium exploitation, smelting and ceramic glazing, lead exposure is a chronic occupational hazard. However, a more serious menace comes from low-level environmental lead exposure. For example, low-level lead exposure from universal usage of inorganic lead products, such as lead paint and batteries, and environmental lead pollution, such as drinking water circulating through lead-soldered plumbing fixtures and pipes, are still major public health problems. Acute Pb poisoning is frequently caused by short-term exposure to high concentrations of Pb, causing nausea, vomit, abdominal distension, constipation, hepatic damage, renal dysfunction, even convulsion and coma. In contrast, chronic Pb poisoning is commonly brought about by long-term exposure to low levels of Pb, leading to the symptoms of abdominal colic, anaemia and toxic encephalopathy, as well as human cancer and birth defect.16 ,17 Although results on carcinogenic properties of inorganic lead compounds are still conflicting, the International Agency for Research on Cancer classified inorganic lead compounds as probable human carcinogens (group 2A).18 One of the underlying mechanisms is that Pb exposure can cause stresses characteristic of over-reactive sympathetic nervous systems and increased levels of cortisol.19 ,20 Accumulating evidence from in vitro cell culture experiments and in vivo animal models, as well as epidemiological studies, has shown that lead poisoning can cause DNA damage, gene mutation and chromosome aberrations.21–24 However, the molecular mechanisms of action of lead are still not fully understood; there are still few studies to report how Pb pollutants affect telomere length. Thus, in this study, we aimed to examine the association of Pb exposure and peripheral white blood cell telomere length (PWBTL) in battery plant workers in South China.

    Materials and methods

    Subjects and study design

    In 2010, 144 battery plant workers, ageing from 18 through 55 years old with the average of 36.6 years and working in a battery plant, were recruited from those workers taking the annual mandatory occupational physical examination. Fifty-nine of those workers examined were women and 85 were men. Based on the regulations of Technical Specifications for Occupational Health Surveillance (The People's Republic of China National Occupational Health Standards, GBZ188-2007), we collected blood and urine specimens from each worker to examine blood lead levels (BLL), fasting plasma glucose (FPG), haemoglobin (Hb) and urine lead levels (ULL). In addition, a questionnaire was administrated to collect general information including gender, birthday, education, income, medical history, smoking and drinking status, as well as recording measured height and weight to calculate body mass index (BMI), which is equal to weight (kg)/height2 (m2). The characteristics of 144 subjects were illustrated in table 1. The average working length was 3.12 years with the variation of 0.62 years. All workers had relatively low education, and most of them only had 9 years of formal school education, while none of the subjects went to college. Of these participants, 64 (44.4%) were smokers who smoke a cigarette or more per day over more than 6 months, and 80 (55.6%) were non-smokers; only 20 (13.9%) were drinkers, who consumed either liquor, beer, wine or rice wine once or more a week over more than 12 months, and 124 were non-drinker. BMI of the participants averaged 24.1 kg/m2 with the SD of 5.5 kg/m2. All workers had taken meals in the same restaurant. None of women were in pregnancy. Within 1 month before the examination, none had fever and other diseases or had taken medicine, which would interfere with calcium metabolism, such as adrenal cortex hormones, vitamin D3 and calcium supplements. The study was approved by the institute ethical review committee.

    View this table:
    Table 1

    Characteristics of study subjects

    Measurement of lead levels in blood and urine and Hb

    Flame atomic absorption spectrometry (Perkin Elmer AA800, Waltham, Massachusetts, USA) was performed on each blood and urine specimen to test BLL and ULL, respectively, based on the manufacturer's protocol. Five millilitres of blood was taken in a new heparin-treated Pb-free tube. Urine was collected over a 24 h period in 2 l plastic bottles, which were previously cleaned thoroughly by pre-treatment with 50 ml of 2% CaNa2EDTA and followed by repeated distilled water rinses. Each sample was analysed in duplicate based on the guidelines of the China National Occupational Health Standards. Hb was measured by using sodium lauryl sulphate (Sysmex xs-1000i, Kobe, Japan). FPG was measured by using a SYNCHRON LX20 Oxygen sensor (Beckman Coulter, Inc., Brea, California, USA). All tests were reported within three working days after the collection.

    Diagnostic criteria and worker compartmentalisation

    According to the Diagnostic Criteria of Occupational Chronic Lead Poisoning (GBZ37-2002) of The People's Republic of China National Occupational Health Standards, any worker whose BLL reaches 1.9 μmol/l (40 μg/dl) and/or ULL reaches 0.34 μmol/l (7.0 μg/dl) has to be admitted as an inpatient within 1 week after the diagnosis (here we classified the subjects as abnormal (or high)), and medical care involving the diagnostic lead mobilisation test and lead chelation therapy will be immediately initiated after admission. Those with both BLL <1.9 μmol/l and ULL <0.34 μmol/l will return to work (here we classified these subjects as normal (or moderate)).

    Calculation of body lead burden

    The workers with the abnormal BLL and/or ULL received lead chelation therapy. The treatment was composed of one or more periods, and each period lasted 7 days, which included intravenous administration of lead chelation therapy in the first 3 days followed by 4 days of clinical observation. The procedure for the lead chelation therapy was as follows: initial intravenous administration of 1 g of calcium disodium EDTA in a 200 ml of normal saline over a 2–4 h period followed by the collection of urine for 24 h for body lead burden (BLB) assessment. This treatment was repeated for another 2 days, and BLL and ULL were re-checked on day 7. If BLL and ULL were still abnormal, another round of treatment was repeated. Total BLB was calculated based on the formula: BLB = ULL (μmol/l) × atomic weight (207.21) × urine amount (ml).25 Any patient who lost one or more urine collections was excluded.

    DNA extraction and telomere length measurement

    Genomic DNA was extracted from the peripheral blood cells in samples using standard procedures of the QIAamp DNA Blood Mini Kit (QIAGEN, Valencia, California, USA) based on the manufacturer's instruction. The concentrations and qualities of the extracted DNA samples were determined by optical density with a NanoDrop ND-1000 spectrophotometer (NanoDrop, Wilmington, Delaware, USA).

    For telomere length analysis, quantitative real-time PCR as developed by Cawthon26 was used to analyse the relative telomere lengths (telomere/single-copy gene of albumin, T/S) with a minor modification. The telomere primer sequences were 5′-ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT (forward) and 5′-TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA (reverse), and for albumin, they were 5′-CGGCGGCGGGCGGCGCGGGCTGGGCGGAAA TGCTGCACAGAATCCTTG (forward) and 5′-GCCCGGCCCGCCGCGCCCGTC CCGCCGGAAAAGCATGGTCGCCTGTT (reverse). Quantitative PCR was performed in the ABI 7300 quantitative real-time PCR detector system (Applied Biosystems, Foster city, California, USA) to obtain Ct values of both telomere and albumin for each sample in two parallel individual plates. Briefly, each PCRs took place in 20 μl of solution that contained 10 μl of 2× Quantifast SYBR green (Invitrogen, Carlsbad, California, USA), either telomere primers (the final concentrations were 900 nM each) or albumin primers (the final concentrations were 900 nM each), and approximately 20 ng of DNA template. The PCR conditions included initial denaturing at 95°C for 15 min, followed by two cycles of 15 s at 94°C and 15 s at 49°C and then 26 cycles of 15 s at 94°C, 10 s at 62°C and 15 s at 73°C with signal acquisition for telomere or for albumin, as appropriate. Standard curves for either telomere (DNA template from 166 ng to 10.4 ng) or albumin (DNA template from 331 ng to 20.7 ng) were run in each plate. After the completion of the PCRs, melting curves were analysed to confirm the purity of PCR products. Each sample was run in duplicate to obtain an average Ct value for each target gene in a sample. Samples with a coefficient of variation for a geometric mean >5% were re-analysed.

    Statistical analysis

    Either a general linear model (GLM) or a Wilcoxon rank-sum test was used to compare the average of continuous variables if appropriate. χ2 Test was performed for categorical variables. Spearman correlation coefficients and their 95% CIs were calculated to assess the correlation of telomere length with other continuous variables. GLMSELECT procedure was used to determine the associations of telomere length with other examined variables in the study based on the smallest values of Akaike's information criteria. Log transformation was performed on BLB in the analyses of correlation and GLMSELECT. All statistical analyses were performed using SAS V.9.2 (SAS Institute Inc.). p Values at 0.05 or smaller (two-sided) were considered statistically significant.

    Results

    Lead levels in blood and urine and their associations with other factors

    Using flame atomic absorption spectrometry, 144 pairs of blood and urine samples from the workers were tested for lead levels. The average of BLL was 2.32 μmol/l (48.1 μg/dl) with the variation of 1.02 μmol/l (21.1 μg/dl), and the average of ULL was 0.18 μmol/l (3.7 μg/dl) with the range of 0.001–1.86 μmol/l (0.02–38.5 μg/dl). Based on the Diagnosis Criteria of Occupational Chronic Lead Poisoning in China, 144 workers were classified into two groups: 84 were abnormal (or high) and 60 were normal (or moderate). The abnormal group, who had to be treated inpatiently, had BLL averaging 2.91 μmol/l (60.3 μg/dl) with a variation of 0.92 μmol/l (19.1 μg/dl) and ULL averaging 0.26 μmol/l (5.4 μg/dl) with the range of 0.01–1.86 μmol/l (0.21–38.5 μg/dl), while the normal group, who were only closely further followed up, but were not clinically treated, had BLL averaging 1.49 μmol/l (30.9 μg/dl) with a variation of 0.35 μmol/l (7.3 μg/dl) and ULL averaging 0.101 μmol/l (2.09 μg/dl) with the range of 0.001–0.336 μmol/l (0.02–6.96 μg/dl). The differences in the BLL and ULL between the two groups were statistically significant, and their p values, respectively, were <0.0001. The BLB in the abnormal group averaged 854.59 μg with a variation of 558.56 μg, whereas BLB was unavailable in the normal group since they were not required to be treated with lead chelation therapy based on regulations in China. The workers with abnormal results had significantly longer working length than those with normal results (3.28 vs 2.90 years, p=0.0002). However, there were no significant differences in gender, smoking and drinking status, education levels, income, age, BMI, Hb and FPG between workers with abnormal and normal results (table 2).

    View this table:
    Table 2

    Associations of lead exposure and variables

    Telomere length in peripheral blood cells and its associations with other factors

    To evaluate the association of telomere length and lead exposure, we measured the relative telomere length (T/S) in peripheral blood cells collected from the 144 battery plant workers using quantitative PCR. The average of telomere length was 1.76 with a variation of 0.58. Workers with abnormal BLL and/or ULL had a significantly shorter telomere lengths than those with normal BLL and/or ULL (p=0.010, table 2). The average telomere length in peripheral blood cells in workers with abnormal measurements was 1.66, while an average telomere length of 1.91 was observed in those with normal results. The difference between the two groups was 0.25, which is equal to approximately 1.77 kb shorter telomere length in workers with abnormal BLL and/or ULL than those with normal measurement based on the method Cawthon recently developed,26 in which a T/S ratio of 1.0 is reported to be equal to approximately 7.06 kb of telomere length in base pairs. Further analyses showed that telomere length in peripheral blood cells was in inverse correlations with BLL, ULL, BMI and working length in years (table 3); their correlation coefficients were −0.21 (95% CI −0.36 to −0.05, p=0.012), −0.22 (95% CI −0.37 to −0.05, p=0.009), −0.17 (95% CI −0.32 to −0.01, p=0.036) and −0.29 (95% CI −0.44 to −0.14, p=0.0003), respectively. A strong inverse correlation was also observed between telomere length and BLB (table 3 and figure 1), the correlation coefficient was −0.70 (95% CI −0.79 to −0.56, p<0.0001). However, we did not observe statistically significant associations between telomere length and either age (p=0.879), FPG (p=0.201), Hb (p=0.115), gender (p=0.329), smoking (p=0.995), drinking (p=0.0613), education (p=0.164) or income (p=0.904).

    View this table:
    Table 3

    Correlation of telomere length and other factors

    Figure 1
    Figure 1

    Correlation of telomere length and body lead burden in the abnormal. Squares indicate the pairs of telomere length (T/S)/body lead burden (BLB) (micrograms) in log. The line is trendline of the correlation of telomere length and BLB in log. The coefficient is obtained using Spearman correlation analysis.

    To estimate the predictive associations between telomere length in peripheral blood cells and other variables, we used the GLMSELECT procedure to construct two models based on the smallest Akaike's information criteria for stepwise selection methods: model I for all subjects and model II for the abnormal subgroup only. In model I for 144 workers, the main effect of variables included age, smoking, drinking, BMI, work length, BLL, ULL, Hb and FPG, whereas in model II, BLB was inserted into model I. In model I, we found telomere length was significantly associated with working length; the estimated coefficient was −0.32 (p<0.0001) (table 4). However, when we only included the subgroup giving abnormal results and who had to be hospitalised in model II, we found three factors, BLB, BLL and working length in years, were significantly in association with telomere length (table 4). The estimated coefficients were −1.72 for BLB in log scale (p<0.0001), 0.11 for BLL (p=0.033) and −0.19 for working length in years (p=0.009). No other factors were selected in the model. We also used the method generalised linear regression full and reduced models to examine the associations of lead exposure factors and followed by the stepwise selection method to select significant factors. The results were the same as the GLMSELECT method (data not shown).

    View this table:
    Table 4

    GLMSELECT model for telomere length and other factors

    Discussion

    In this study, we demonstrated the relationships between occupational biological lead exposure and telomere length in peripheral blood cells of Chinese battery manufacturing plant workers. We found 84 (58%) of 144 workers who were mandatorily required to have an annual physical examination had higher lead levels in their blood and/or urine than regulations allowed and had to be hospitalised for treatment. Although some of the subjects had been hospitalised a year before enrolment in the current study and had been employed at the plant an average of 3 years, the prevalence of blood and urine lead was relatively high. In our field survey, we found that two major potential issues, occupational health protection and health education, should receive greater attention. In the occupational health protection, two of the most important protective approaches, wearing respirators to prevent the intake of lead dust and lead smoke and personal hygiene (showering before leaving for home at the end of the work day) to reduce the potential absorption via skin, were frequently ignored by the workers. Additionally, since the workers possessed low levels of education with the maximum of 12 years, they did not have sufficient knowledge regarding lead toxicity and health protection. Thus, it is necessary to intensify worker education and knowledge of lead exposure, occupational protection and health.

    BLL and ULL are the most frequently used indices in evaluating the history of Pb exposure; these levels reflect the most recent lead exposure during the last week, while they are not necessarily correlated to the quantity of lead accumulated in the body.27 In addition, ULL can be affected by kidney function to some extent, making it not so reliable as BLL. Evidence has shown that BLL at a level <10 μg/dl, far below the ‘poisoning concentration’, can cause health problems. In our study, the workers had an average of 2.32 μmol/l (more than 40 μg/dl) BLL, which is higher than the acceptable levels of 25 μg/dl BLL for adults.28 As expected, we also found that the workers with abnormal levels had longer working histories in the plant than did the workers with normal levels and that BLL was positively correlated with working length in the battery plant (r=0.25, 95% CI 0.08 to 0.39, p=0.003). This result indicated that working length, to a certain extent, could relatively represent the levels of lead exposure.

    We also found that the workers with abnormal levels had significantly shorter PWBTL than those with normal levels. Further correlation analyses based on all workers showed that PWBTL was in inverse correlations with BLL and ULL, as well as work length and BMI (table 3). However, there were no correlations found between PWBTL with other examined factors including age, FPG and Hb. These findings suggested that PWBTL was negatively associated with the lead exposure index of working length in years and was negatively associated with the biological lead exposure index of both BLL and ULL. Moreover, one of the reasons why no significant association between age and telomere length was found in our study is that age-induced telomere shortening might have been masked by the effect of lead exposure because our study subjects had relatively high lead exposure.

    Following this lead, we did multivariate analyses to investigate what factor(s) are involved in PWBTL shortening. To achieve this purpose, we applied GLMSELECT model for all 144 workers and the subgroup of 84 workers who were hospitalised, respectively. When all workers were included, only working length was selected and in inverse association with telomere length; the estimated coefficient was −0.32 (table 4). However, when GLMSELCT model was employed for the subgroup of the inpatient workers, BLB, BLL and working length were significantly in association with PWBTL (table 4); both BLB and working length were clearly pronounced in negative association with PWBTL; their estimated coefficients were −1.72 and −0.19, respectively. In contrast, BLL was positively associated with PWBTL, and the estimate coefficient was 0.11. These findings suggest that cumulative lead absorption has a significant effect on telomere length shortening. Our results are consistent with other previous reports. Cui and colleagues29 reported that telomere length shortening was observed in Saccharomyces cerevisiae exposed to lead. These researchers found heavy metal lead could inhibit telomerase activity by influencing shelterin proteins Rap1p, resulting in telomere length shortening and cell death. Gump et al19 ,20 showed that lead exposure could cause over-reactive sympathetic nervous systems and increased levels of cortisol, the hallmarkers of physiological stresses, which have been reported to cause telomere length shortening.2 Similar results of telomere length shortening are also observed following exposure to other heavy metal ions, which cause both acute chromosome damage and genomic instability in the progeny of exposed cells.14 ,15 ,30

    Interestingly, the multivariate analysis results showed that BLL was in positive, despite weak (table 4), correlation with PWBTL in the subgroup of the inpatient workers. This finding is consistent with the univariate analysis of the correlation (r=0.15, and p=0.164) between telomere length and BLL in the subgroup (data not shown) but seems contrary to our expectations that BLL is inversely associated with PWBTL as in the whole group (r=−0.21). However, it has been reported that steel workers with short-term metal-rich particulate matter exposure within a week's duration had longer telomere length compared with baseline samples.31 Similarly, it has been recently demonstrated that low-level lead exposure could increase and prolong retinal progenitor cell proliferation, rather than apoptosis.32 Although our finding suggests that Pb at a certain level in blood (short-term Pb exposure) may increase telomere length, since BLB (β=−1.72) played a predominant effect on PWBTL, and the inpatient workers showed relatively high long-term Pb exposure doses, it would not be surprising that comprehensive consequence of lead exposure in the battery plant workers was telomere length shortening. Additionally, these findings also suggest that telomere length shortening is an accumulated consequence of the total amount of lead exposure. However, given the limitation of our study in the sample size that is relatively small, we must interpret our results cautiously. Our results are necessary to be further validated in independent study with large sample sizes as well as through the longitudinal approach, repeating the measurements of Pb exposure and telomere length over time.

    Our study also demonstrated a strong negative correlation between BLB and PWBTL. Blood level burden is an integrative index, which reflects cumulative lead absorption.33 Bone uptake of lead has been thought to be an essential step of sequestering and functionally detoxifying mechanisms, providing protective roles by effectively removing lead from the bioavailable blood compartment and depositing them in bone. However, BLB can act as a reservoir from which Pb is released into blood under certain conditions, making BLL rise again even though BLL has turned normal.33 ,34 Although CaNa2EDTA is a widely used chelating agent in the treatment of lead poisoning, it is of limited value in removing deposited Pb from the human body. When the treatment is stopped, even though a person is no longer exposed to lead, BLL may rise because deposited lead in bone is released into blood. Thus, BLB may elicit more persistent and enduring harmful outcomes.

    In agreement with previous studies on telomere length and BMI, we also found a significantly negative correlation between telomere length and BMI (table 3). Kim et al35 reported that women with high BMI had shorter telomere length than those with low BMI. Similar results were also observed in other studies.36 ,37 These consistent findings suggest that our findings in telomere length shortening and lead exposure are not by chance.

    Given that telomere length plays a critical role in genome stability, our results extend insight into the potential molecular mechanisms of lead genotoxicity and are in support of the findings reported in previous studies. Wozniak and Blasiak38 using in vitro cell culture experiments found that lead acetate could induce DNA single- and double-strand breaks. Significant increases in micronucleus frequency, T cell receptor gene mutation and DNA damage have been demonstrated in the workers who were occupationally exposed to lead.21 ,23 ,24 ,39 In comparison to controls, the workers exposed to lead had significantly elevated frequencies of sister-chromosome exchange and increased percentage of lymphocytes with DNA fragmentation.40 It will be very interesting to investigate whether telomere length shortening can make cells hypersensitive to lead-induced genotoxicity and how telomere length changes in the general population with low-level lead exposure.

    Conclusions

    Our study demonstrated that telomere length shortening is associated with the length of lead exposure and biological exposure index of BLB, as well as possibly associated with lead levels in blood and urine based on a cross-section study of workers in a battery manufacturing plant. We also found that those workers with high lead exposure levels had shorter telomere length than those with low-level exposure. These findings suggested that long-term lead exposure could result in telomere length shortening, which may be one of the underlying mechanisms of lead-induced ageing and other health problems.

    Acknowledgments

    We thank Dr Michael E Hume for critical reading and editing. The Authors also thank all study participants who made the research possible.

    References

    1. ↵
      1. Blackburn EH
      . Switching and signaling at the telomere. Cell 2001;106:661–73.
      OpenUrlCrossRefPubMedWeb of Science
    2. ↵
      1. Epel ES,
      2. Blackburn EH,
      3. Lin J,
      4. et al
      . Accelerated telomere shortening in response to life stress. Proc Natl Acad Sci U S A 2004;101:17312–15.
      OpenUrlAbstract/FREE Full Text
    3. ↵
      1. Cawthon RM,
      2. Smith KR,
      3. O'Brien E,
      4. et al
      . Association between telomere length in blood and mortality in people aged 60 years or older. Lancet 2003;361:393–5.
      OpenUrlCrossRefPubMedWeb of Science
    4. ↵
      1. Bakaysa SL,
      2. Mucci LA,
      3. Slagboom PE,
      4. et al
      . Telomere length predicts survival independent of genetic influences. Aging Cell 2007;6:769–74.
      OpenUrlCrossRefPubMedWeb of Science
    5. ↵
      1. Wolkowitz OM,
      2. Mellon SH,
      3. Epel ES,
      4. et al
      . Leukocyte telomere length in major depression: correlations with chronicity, inflammation and oxidative stress—preliminary findings. PLoS One 2011;6:e17837.
      OpenUrlCrossRefPubMed
    6. ↵
      1. Wu X,
      2. Amos CI,
      3. Zhu Y,
      4. et al
      . Telomere dysfunction: a potential cancer predisposition factor. J Natl Cancer Inst 2003;95:1211–18.
      OpenUrlAbstract/FREE Full Text
    7. ↵
      1. Brouilette S,
      2. Singh RK,
      3. Thompson JR,
      4. et al
      . White cell telomere length and risk of premature myocardial infarction. Arterioscler Thromb Vasc Biol 2003;23:842–6.
      OpenUrlAbstract/FREE Full Text
    8. ↵
      1. Fitzpatrick AL,
      2. Kronmal RA,
      3. Gardner JP,
      4. et al
      . Leukocyte telomere length and cardiovascular disease in the cardiovascular health study. Am J Epidemiol 2007;165:14–21.
      OpenUrlAbstract/FREE Full Text
    9. ↵
      1. Samani NJ,
      2. Boultby R,
      3. Butler R,
      4. et al
      . Telomere shortening in atherosclerosis. Lancet 2001;358:472–3.
      OpenUrlCrossRefPubMedWeb of Science
    10. ↵
      1. Houben JM,
      2. Moonen HJ,
      3. van Schooten FJ,
      4. et al
      . Telomere length assessment: biomarker of chronic oxidative stress? Free Radic Biol Med 2008;44:235–46.
      OpenUrlCrossRefPubMedWeb of Science
    11. ↵
      1. Puterman E,
      2. Lin J,
      3. Blackburn E,
      4. et al
      . The power of exercise: buffering the effect of chronic stress on telomere length. PLoS One 2010;5:e10837.
      OpenUrlCrossRefPubMed
    12. ↵
      1. Barbieri M,
      2. Paolisso G,
      3. Kimura M,
      4. et al
      . Higher circulating levels of IGF-1 are associated with longer leukocyte telomere length in healthy subjects. Mech Ageing Dev 2009;130:771–6.
      OpenUrlCrossRefPubMedWeb of Science
    13. ↵
      1. Strub GM,
      2. Depcrynski A,
      3. Elmore LW,
      4. et al
      . Recovery from stress is a function of age and telomere length. Cell Stress Chaperones 2008;13:475–82.
      OpenUrlCrossRefPubMedWeb of Science
    14. ↵
      1. Coen N,
      2. Mothersill C,
      3. Kadhim M,
      4. et al
      . Heavy metals of relevance to human health induce genomic instability. J Pathol 2001;195:293–9.
      OpenUrlCrossRefPubMedWeb of Science
    15. ↵
      1. Coen N,
      2. Kadhim MA,
      3. Wright EG,
      4. et al
      . Particulate debris from a titanium metal prosthesis induces genomic instability in primary human fibroblast cells. Br J Cancer 2003;88:548–52.
      OpenUrlCrossRefPubMedWeb of Science
    16. ↵
      1. Fu H,
      2. Boffetta P
      . Cancer and occupational exposure to inorganic lead compounds: a meta-analysis of published data. Occup Environ Med 1995;52:73–81.
      OpenUrlAbstract/FREE Full Text
    17. ↵
      1. Johnson FM
      . The genetic effects of environmental lead. Mutat Res 1998;410:123–40.
      OpenUrlCrossRefPubMedWeb of Science
    18. ↵
      IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Inorganic and organic lead compounds. IARC Monogr Eval Carcinog Risks Hum 2006;87:1–471.
      OpenUrlPubMed
    19. ↵
      1. Gump BB,
      2. Reihman J,
      3. Stewart P,
      4. et al
      . Blood lead (Pb) levels: a potential environmental mechanism explaining the relation between socioeconomic status and cardiovascular reactivity in children. Health Psychol 2007;26:296–304.
      OpenUrlCrossRefPubMedWeb of Science
    20. ↵
      1. Gump BB,
      2. Reihman J,
      3. Stewart P,
      4. et al
      . Blood lead (Pb) levels: further evidence for an environmental mechanism explaining the association between socioeconomic status and psychophysiological dysregulation in children. Health Psychol 2009;28:614–20.
      OpenUrlCrossRefPubMedWeb of Science
    21. ↵
      1. Garcia-Leston J,
      2. Roma-Torres J,
      3. Vilares M,
      4. et al
      . Biomonitoring of a population of Portuguese workers exposed to lead. Mutat Res 2011;721:81–8.
      OpenUrlPubMedWeb of Science
    22. ↵
      1. Garcia-Leston J,
      2. Mendez J,
      3. Pasaro E,
      4. et al
      . Genotoxic effects of lead: an updated review. Environ Int 2010;36:623–36.
      OpenUrlCrossRefPubMedWeb of Science
    23. ↵
      1. Kasuba V,
      2. Rozgaj R,
      3. Milic M,
      4. et al
      . Evaluation of lead exposure in battery-manufacturing workers with focus on different biomarkers. J Appl Toxicol 2010;30:321–8.
      OpenUrlPubMed
    24. ↵
      1. Khan MI,
      2. Ahmad I,
      3. Mahdi AA,
      4. et al
      . Elevated blood lead levels and cytogenetic markers in buccal epithelial cells of painters in India: genotoxicity in painters exposed to lead containing paints. Environ Sci Pollut Res Int 2010;17:1347–54.
      OpenUrlCrossRefPubMedWeb of Science
    25. ↵
      1. Lin JL,
      2. Lin-Tan DT,
      3. Hsu KH,
      4. et al
      . Environmental lead exposure and progression of chronic renal diseases in patients without diabetes. N Engl J Med 2003;348:277–86.
      OpenUrlCrossRefPubMedWeb of Science
    26. ↵
      1. Cawthon RM
      . Telomere length measurement by a novel monochrome multiplex quantitative PCR method. Nucleic Acids Res 2009;37:e21.
      OpenUrlAbstract/FREE Full Text
    27. ↵
      1. Schwartz BS,
      2. McGrail MP,
      3. Stewart W,
      4. et al
      . Comparison of measures of lead exposure, dose, and chelatable lead burden after provocative chelation in organolead workers. Occup Environ Med 1994;51:669–73.
      OpenUrlAbstract/FREE Full Text
    28. ↵
      1. Wu A
      . Tietz Clinical Guide to Laboratory Tests. St. Louis, MO: Saunders Elsevier, 2006.
    29. ↵
      1. Cui QH,
      2. Tang CC,
      3. Huang YG
      . [Effects of lead and selenium on telomere binding protein Rap1p, telomerase and telomeric DNA in Saccharomyces cerevisiae]. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 2002;34:240–4.
      OpenUrlPubMed
    30. ↵
      1. Glaviano A,
      2. Nayak V,
      3. Cabuy E,
      4. et al
      . Effects of hTERT on metal ion-induced genomic instability. Oncogene 2006;25:3424–35.
      OpenUrlCrossRefPubMedWeb of Science
    31. ↵
      1. Dioni L,
      2. Hoxha M,
      3. Nordio F,
      4. et al
      . Effects of short-term exposure to inhalable particulate matter on telomere length, telomerase expression, and telomerase methylation in steel workers. Environ Health Perspect 2010;119:622–7.
      OpenUrlCrossRefPubMedWeb of Science
    32. ↵
      1. Giddabasappa A,
      2. Hamilton WR,
      3. Chaney S,
      4. et al
      . Low-level gestational lead exposure increases retinal progenitor cell proliferation and rod photoreceptor and bipolar cell neurogenesis in mice. Environ Health Perspect 2011;119:71–7.
      OpenUrlPubMedWeb of Science
    33. ↵
      1. Silbergeld EK,
      2. Schwartz J,
      3. Mahaffey K
      . Lead and osteoporosis: mobilization of lead from bone in postmenopausal women. Environ Res 1988;47:79–94.
      OpenUrlPubMed
    34. ↵
      1. Wedeen RP
      . Use of the CaNa2 EDTA Pb-mobilization test to detect occult lead nephropathy. Uremia Invest 1985;9:127–30.
      OpenUrlPubMedWeb of Science
    35. ↵
      1. Kim S,
      2. Parks CG,
      3. DeRoo LA,
      4. et al
      . Obesity and weight gain in adulthood and telomere length. Cancer Epidemiol Biomark Prev 2009;18:816–20.
      OpenUrlAbstract/FREE Full Text
    36. ↵
      1. Lee M,
      2. Martin H,
      3. Firpo MA,
      4. et al
      . Inverse association between adiposity and telomere length: the Fels Longitudinal Study. Am J Hum Biol 2011;23:100–6.
      OpenUrlCrossRefPubMed
    37. ↵
      1. Moreno-Navarrete JM,
      2. Ortega F,
      3. Sabater M,
      4. et al
      . Telomere length of subcutaneous adipose tissue cells is shorter in obese and formerly obese subjects. Int J Obes (Lond) 2010;34:1345–8.
      OpenUrlCrossRefPubMed
    38. ↵
      1. Wozniak K,
      2. Blasiak J
      . In vitro genotoxicity of lead acetate: induction of single and double DNA strand breaks and DNA-protein cross-links. Mutat Res 2003;535:127–39.
      OpenUrlPubMedWeb of Science
    39. ↵
      1. Chen Z,
      2. Lou J,
      3. Chen S,
      4. et al
      . Evaluating the genotoxic effects of workers exposed to lead using micronucleus assay, comet assay and TCR gene mutation test. Toxicology 2006;223:219–26.
      OpenUrlCrossRefPubMedWeb of Science
    40. ↵
      1. Palus J,
      2. Rydzynski K,
      3. Dziubaltowska E,
      4. et al
      . Genotoxic effects of occupational exposure to lead and cadmium. Mutat Res 2003;540:19–28.
      OpenUrlCrossRefPubMedWeb of Science

    Footnotes

    • Funding This study was supported by the Key Program of Medical Scientific Research Foundation of Guangzhou Municipality (No.2007-Zdi-02) of Guangdong Province, China.

    • Competing interests None.

    • Patient consent Obtained.

    • Ethics approval Ethics approval was provided by University Ethical Review Committee.

    • Provenance and peer review Not commissioned; externally peer reviewed.